SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma06g10311

Feature Type:gene_model
Chromosome:Gm06
Start:7784517
stop:7786102
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
UniRef100_B9SMZ2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Alpha-glucan water dikinase, chloroplast, putative n=1 Tax=Ricinus communis RepID=B9SMZ2_RICCO SoyBaseE_val: 2.00E-11ISS
UniRef100_I1K9S9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K9S9_SOYBN SoyBaseE_val: 5.00E-73ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g10311 not represented in the dataset

Glyma06g10311 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g10375 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g098200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g10311.1   sequence type=CDS   gene model=Glyma06g10311   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACCGTCTGGGTCAAGCAACAATGCCATGGCTTCTCCTCGTGTTCTTCATTTTGATCTAATTGAAGGAATGCAGCTTGCGCAAAATTATGATATTGCATTGAGAGAGCTCCCAAGTCACTTACCAAAAGGAATAACCTTGACCAAGTCACGGAATAGCTATCTAACTGGAAGAATAAAACCTGTGAATGATAACAGAGATCAACTCAGAAGTGGTATGCACTATTCCTACCTTAGGAAATACAATATTGAAGACTGGTTGCAAAAGCATTCTGAAGGGCATGCCAAAGGAGCCATATCAACAGCAGCTCTTATAGAGAATTTTATAGGGGGAACAGATGTACTGTCAAAGCAAATATATCATGTTCATAACTATGAGATTATGAATGTTGATAAGGGGCAAGAGGTGGAGATATTGGTGGCTAGCGGTAACATGGGCTATTTGGAAGTTTAG

>Glyma06g10311.1   sequence type=predicted peptide   gene model=Glyma06g10311   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPSGSSNNAMASPRVLHFDLIEGMQLAQNYDIALRELPSHLPKGITLTKSRNSYLTGRIKPVNDNRDQLRSGMHYSYLRKYNIEDWLQKHSEGHAKGAISTAALIENFIGGTDVLSKQIYHVHNYEIMNVDKGQEVEILVASGNMGYLEV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo